ID: 938159450

View in Genome Browser
Species Human (GRCh38)
Location 2:128972657-128972679
Sequence GCAGGCTGGACGCCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159446_938159450 -9 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159441_938159450 25 Left 938159441 2:128972609-128972631 CCTCTTAGAGCCTAAGCATCGTG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159444_938159450 -5 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159442_938159450 15 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159443_938159450 -1 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159450 Original CRISPR GCAGGCTGGACGCCTGGCCC TGG Intergenic