ID: 938159452

View in Genome Browser
Species Human (GRCh38)
Location 2:128972669-128972691
Sequence GTCCACTCAAGGCCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159452_938159458 -10 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159452_938159461 -2 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159452_938159463 8 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159463 2:128972700-128972722 GGTGGGAAATGGGGTACTCTTGG No data
938159452_938159462 -1 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159462 2:128972691-128972713 CAGGCTAAAGGTGGGAAATGGGG No data
938159452_938159465 15 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159465 2:128972707-128972729 AATGGGGTACTCTTGGGCACTGG No data
938159452_938159460 -3 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159460 2:128972689-128972711 GACAGGCTAAAGGTGGGAAATGG No data
938159452_938159464 9 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159452_938159459 -9 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159452 Original CRISPR GTCCACTCAAGGCCAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr