ID: 938159453

View in Genome Browser
Species Human (GRCh38)
Location 2:128972672-128972694
Sequence GGCCCTGGCCTTGAGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159446_938159453 6 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159448_938159453 1 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159444_938159453 10 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159442_938159453 30 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159443_938159453 14 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159453 Original CRISPR GGCCCTGGCCTTGAGTGGAC AGG Intergenic
No off target data available for this crispr