ID: 938159454

View in Genome Browser
Species Human (GRCh38)
Location 2:128972674-128972696
Sequence AGCCTGTCCACTCAAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159454_938159463 3 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159463 2:128972700-128972722 GGTGGGAAATGGGGTACTCTTGG No data
938159454_938159465 10 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159465 2:128972707-128972729 AATGGGGTACTCTTGGGCACTGG No data
938159454_938159461 -7 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159454_938159466 30 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159466 2:128972727-128972749 TGGCCCCTACGATCTCACAGAGG No data
938159454_938159462 -6 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159462 2:128972691-128972713 CAGGCTAAAGGTGGGAAATGGGG No data
938159454_938159464 4 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159454_938159460 -8 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159460 2:128972689-128972711 GACAGGCTAAAGGTGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159454 Original CRISPR AGCCTGTCCACTCAAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr