ID: 938159456

View in Genome Browser
Species Human (GRCh38)
Location 2:128972679-128972701
Sequence GCCTTGAGTGGACAGGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159443_938159456 21 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159444_938159456 17 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159446_938159456 13 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159448_938159456 8 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159456 Original CRISPR GCCTTGAGTGGACAGGCTAA AGG Intergenic
No off target data available for this crispr