ID: 938159457

View in Genome Browser
Species Human (GRCh38)
Location 2:128972680-128972702
Sequence ACCTTTAGCCTGTCCACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159457_938159464 -2 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159457_938159467 25 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159467 2:128972728-128972750 GGCCCCTACGATCTCACAGAGGG No data
938159457_938159465 4 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159465 2:128972707-128972729 AATGGGGTACTCTTGGGCACTGG No data
938159457_938159472 29 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159472 2:128972732-128972754 CCTACGATCTCACAGAGGGAGGG No data
938159457_938159463 -3 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159463 2:128972700-128972722 GGTGGGAAATGGGGTACTCTTGG No data
938159457_938159470 28 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159470 2:128972731-128972753 CCCTACGATCTCACAGAGGGAGG No data
938159457_938159466 24 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159466 2:128972727-128972749 TGGCCCCTACGATCTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159457 Original CRISPR ACCTTTAGCCTGTCCACTCA AGG (reversed) Intergenic