ID: 938159458

View in Genome Browser
Species Human (GRCh38)
Location 2:128972682-128972704
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159452_938159458 -10 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159448_938159458 11 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159444_938159458 20 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159443_938159458 24 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159446_938159458 16 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type