ID: 938159459

View in Genome Browser
Species Human (GRCh38)
Location 2:128972683-128972705
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159443_938159459 25 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159448_938159459 12 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159444_938159459 21 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159452_938159459 -9 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159446_938159459 17 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type