ID: 938159461

View in Genome Browser
Species Human (GRCh38)
Location 2:128972690-128972712
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159444_938159461 28 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159455_938159461 -8 Left 938159455 2:128972675-128972697 CCTGGCCTTGAGTGGACAGGCTA No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159448_938159461 19 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159446_938159461 24 Left 938159446 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159452_938159461 -2 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159454_938159461 -7 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type