ID: 938159464

View in Genome Browser
Species Human (GRCh38)
Location 2:128972701-128972723
Sequence GTGGGAAATGGGGTACTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159452_938159464 9 Left 938159452 2:128972669-128972691 CCTGGCCCTGGCCTTGAGTGGAC No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159448_938159464 30 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159455_938159464 3 Left 938159455 2:128972675-128972697 CCTGGCCTTGAGTGGACAGGCTA No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159457_938159464 -2 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159454_938159464 4 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159464 Original CRISPR GTGGGAAATGGGGTACTCTT GGG Intergenic
No off target data available for this crispr