ID: 938159466

View in Genome Browser
Species Human (GRCh38)
Location 2:128972727-128972749
Sequence TGGCCCCTACGATCTCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159455_938159466 29 Left 938159455 2:128972675-128972697 CCTGGCCTTGAGTGGACAGGCTA No data
Right 938159466 2:128972727-128972749 TGGCCCCTACGATCTCACAGAGG No data
938159454_938159466 30 Left 938159454 2:128972674-128972696 CCCTGGCCTTGAGTGGACAGGCT No data
Right 938159466 2:128972727-128972749 TGGCCCCTACGATCTCACAGAGG No data
938159457_938159466 24 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159466 2:128972727-128972749 TGGCCCCTACGATCTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159466 Original CRISPR TGGCCCCTACGATCTCACAG AGG Intergenic
No off target data available for this crispr