ID: 938159467 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:128972728-128972750 |
Sequence | GGCCCCTACGATCTCACAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938159455_938159467 | 30 | Left | 938159455 | 2:128972675-128972697 | CCTGGCCTTGAGTGGACAGGCTA | No data | ||
Right | 938159467 | 2:128972728-128972750 | GGCCCCTACGATCTCACAGAGGG | No data | ||||
938159457_938159467 | 25 | Left | 938159457 | 2:128972680-128972702 | CCTTGAGTGGACAGGCTAAAGGT | No data | ||
Right | 938159467 | 2:128972728-128972750 | GGCCCCTACGATCTCACAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938159467 | Original CRISPR | GGCCCCTACGATCTCACAGA GGG | Intergenic | ||