ID: 938159467

View in Genome Browser
Species Human (GRCh38)
Location 2:128972728-128972750
Sequence GGCCCCTACGATCTCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159457_938159467 25 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159467 2:128972728-128972750 GGCCCCTACGATCTCACAGAGGG No data
938159455_938159467 30 Left 938159455 2:128972675-128972697 CCTGGCCTTGAGTGGACAGGCTA No data
Right 938159467 2:128972728-128972750 GGCCCCTACGATCTCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159467 Original CRISPR GGCCCCTACGATCTCACAGA GGG Intergenic
No off target data available for this crispr