ID: 938159470

View in Genome Browser
Species Human (GRCh38)
Location 2:128972731-128972753
Sequence CCCTACGATCTCACAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159457_938159470 28 Left 938159457 2:128972680-128972702 CCTTGAGTGGACAGGCTAAAGGT No data
Right 938159470 2:128972731-128972753 CCCTACGATCTCACAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159470 Original CRISPR CCCTACGATCTCACAGAGGG AGG Intergenic
No off target data available for this crispr