ID: 938159470 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:128972731-128972753 |
| Sequence | CCCTACGATCTCACAGAGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938159457_938159470 | 28 | Left | 938159457 | 2:128972680-128972702 | CCTTGAGTGGACAGGCTAAAGGT | No data | ||
| Right | 938159470 | 2:128972731-128972753 | CCCTACGATCTCACAGAGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938159470 | Original CRISPR | CCCTACGATCTCACAGAGGG AGG | Intergenic | ||