ID: 938159602

View in Genome Browser
Species Human (GRCh38)
Location 2:128973463-128973485
Sequence TGACATGGCCACAGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159602_938159608 26 Left 938159602 2:128973463-128973485 CCAGGGCCTCTGTGGCCATGTCA No data
Right 938159608 2:128973512-128973534 TGTAGTTCTACATGGTGTATAGG No data
938159602_938159610 30 Left 938159602 2:128973463-128973485 CCAGGGCCTCTGTGGCCATGTCA No data
Right 938159610 2:128973516-128973538 GTTCTACATGGTGTATAGGGTGG No data
938159602_938159607 18 Left 938159602 2:128973463-128973485 CCAGGGCCTCTGTGGCCATGTCA No data
Right 938159607 2:128973504-128973526 GAAATATTTGTAGTTCTACATGG No data
938159602_938159609 27 Left 938159602 2:128973463-128973485 CCAGGGCCTCTGTGGCCATGTCA No data
Right 938159609 2:128973513-128973535 GTAGTTCTACATGGTGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159602 Original CRISPR TGACATGGCCACAGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr