ID: 938165972

View in Genome Browser
Species Human (GRCh38)
Location 2:129027284-129027306
Sequence GCCATGCCCCGCCTTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938165970_938165972 8 Left 938165970 2:129027253-129027275 CCATTCTTTCATAATCATGAATG No data
Right 938165972 2:129027284-129027306 GCCATGCCCCGCCTTGTGCTGGG No data
938165968_938165972 19 Left 938165968 2:129027242-129027264 CCCAAATGGTTCCATTCTTTCAT No data
Right 938165972 2:129027284-129027306 GCCATGCCCCGCCTTGTGCTGGG No data
938165969_938165972 18 Left 938165969 2:129027243-129027265 CCAAATGGTTCCATTCTTTCATA No data
Right 938165972 2:129027284-129027306 GCCATGCCCCGCCTTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938165972 Original CRISPR GCCATGCCCCGCCTTGTGCT GGG Intergenic
No off target data available for this crispr