ID: 938166451

View in Genome Browser
Species Human (GRCh38)
Location 2:129031646-129031668
Sequence GCCATGAAGTCTAATTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938166451_938166454 17 Left 938166451 2:129031646-129031668 CCAGGCAAATTAGACTTCATGGC No data
Right 938166454 2:129031686-129031708 CCCTGAGACAAATACAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938166451 Original CRISPR GCCATGAAGTCTAATTTGCC TGG (reversed) Intergenic