ID: 938168690

View in Genome Browser
Species Human (GRCh38)
Location 2:129056348-129056370
Sequence ATGGTGAATTAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938168685_938168690 4 Left 938168685 2:129056321-129056343 CCACTTTTTACAGAGAATGCAGC No data
Right 938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938168690 Original CRISPR ATGGTGAATTAGAAAGAGGC TGG Intergenic
No off target data available for this crispr