ID: 938168690 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:129056348-129056370 |
| Sequence | ATGGTGAATTAGAAAGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938168685_938168690 | 4 | Left | 938168685 | 2:129056321-129056343 | CCACTTTTTACAGAGAATGCAGC | No data | ||
| Right | 938168690 | 2:129056348-129056370 | ATGGTGAATTAGAAAGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938168690 | Original CRISPR | ATGGTGAATTAGAAAGAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||