ID: 938169411

View in Genome Browser
Species Human (GRCh38)
Location 2:129061580-129061602
Sequence GGCCAGCAGGGCAATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169411_938169419 5 Left 938169411 2:129061580-129061602 CCCACACCATTGCCCTGCTGGCC No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169411_938169421 17 Left 938169411 2:129061580-129061602 CCCACACCATTGCCCTGCTGGCC No data
Right 938169421 2:129061620-129061642 GTTCAAGATGGTCATTGCAGTGG No data
938169411_938169417 -5 Left 938169411 2:129061580-129061602 CCCACACCATTGCCCTGCTGGCC No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169411 Original CRISPR GGCCAGCAGGGCAATGGTGT GGG (reversed) Intergenic
No off target data available for this crispr