ID: 938169412

View in Genome Browser
Species Human (GRCh38)
Location 2:129061581-129061603
Sequence AGGCCAGCAGGGCAATGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169412_938169421 16 Left 938169412 2:129061581-129061603 CCACACCATTGCCCTGCTGGCCT No data
Right 938169421 2:129061620-129061642 GTTCAAGATGGTCATTGCAGTGG No data
938169412_938169417 -6 Left 938169412 2:129061581-129061603 CCACACCATTGCCCTGCTGGCCT No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data
938169412_938169419 4 Left 938169412 2:129061581-129061603 CCACACCATTGCCCTGCTGGCCT No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169412 Original CRISPR AGGCCAGCAGGGCAATGGTG TGG (reversed) Intergenic
No off target data available for this crispr