ID: 938169413

View in Genome Browser
Species Human (GRCh38)
Location 2:129061586-129061608
Sequence ACATGAGGCCAGCAGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169413_938169419 -1 Left 938169413 2:129061586-129061608 CCATTGCCCTGCTGGCCTCATGT No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169413_938169421 11 Left 938169413 2:129061586-129061608 CCATTGCCCTGCTGGCCTCATGT No data
Right 938169421 2:129061620-129061642 GTTCAAGATGGTCATTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169413 Original CRISPR ACATGAGGCCAGCAGGGCAA TGG (reversed) Intergenic
No off target data available for this crispr