ID: 938169414

View in Genome Browser
Species Human (GRCh38)
Location 2:129061592-129061614
Sequence CCAAACACATGAGGCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169414_938169421 5 Left 938169414 2:129061592-129061614 CCCTGCTGGCCTCATGTGTTTGG No data
Right 938169421 2:129061620-129061642 GTTCAAGATGGTCATTGCAGTGG No data
938169414_938169419 -7 Left 938169414 2:129061592-129061614 CCCTGCTGGCCTCATGTGTTTGG No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169414_938169422 30 Left 938169414 2:129061592-129061614 CCCTGCTGGCCTCATGTGTTTGG No data
Right 938169422 2:129061645-129061667 GCTGCTTTATCTGCTTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169414 Original CRISPR CCAAACACATGAGGCCAGCA GGG (reversed) Intergenic
No off target data available for this crispr