ID: 938169417

View in Genome Browser
Species Human (GRCh38)
Location 2:129061598-129061620
Sequence TGGCCTCATGTGTTTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169408_938169417 29 Left 938169408 2:129061546-129061568 CCTTGCAGATCACAGGCACAATG No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data
938169412_938169417 -6 Left 938169412 2:129061581-129061603 CCACACCATTGCCCTGCTGGCCT No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data
938169407_938169417 30 Left 938169407 2:129061545-129061567 CCCTTGCAGATCACAGGCACAAT No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data
938169411_938169417 -5 Left 938169411 2:129061580-129061602 CCCACACCATTGCCCTGCTGGCC No data
Right 938169417 2:129061598-129061620 TGGCCTCATGTGTTTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169417 Original CRISPR TGGCCTCATGTGTTTGGACC AGG Intergenic
No off target data available for this crispr