ID: 938169418

View in Genome Browser
Species Human (GRCh38)
Location 2:129061601-129061623
Sequence GAACCTGGTCCAAACACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169418_938169422 21 Left 938169418 2:129061601-129061623 CCTCATGTGTTTGGACCAGGTTC No data
Right 938169422 2:129061645-129061667 GCTGCTTTATCTGCTTTGCTAGG No data
938169418_938169421 -4 Left 938169418 2:129061601-129061623 CCTCATGTGTTTGGACCAGGTTC No data
Right 938169421 2:129061620-129061642 GTTCAAGATGGTCATTGCAGTGG No data
938169418_938169423 28 Left 938169418 2:129061601-129061623 CCTCATGTGTTTGGACCAGGTTC No data
Right 938169423 2:129061652-129061674 TATCTGCTTTGCTAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169418 Original CRISPR GAACCTGGTCCAAACACATG AGG (reversed) Intergenic
No off target data available for this crispr