ID: 938169419

View in Genome Browser
Species Human (GRCh38)
Location 2:129061608-129061630
Sequence TGTTTGGACCAGGTTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169413_938169419 -1 Left 938169413 2:129061586-129061608 CCATTGCCCTGCTGGCCTCATGT No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169414_938169419 -7 Left 938169414 2:129061592-129061614 CCCTGCTGGCCTCATGTGTTTGG No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169411_938169419 5 Left 938169411 2:129061580-129061602 CCCACACCATTGCCCTGCTGGCC No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169416_938169419 -8 Left 938169416 2:129061593-129061615 CCTGCTGGCCTCATGTGTTTGGA No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data
938169412_938169419 4 Left 938169412 2:129061581-129061603 CCACACCATTGCCCTGCTGGCCT No data
Right 938169419 2:129061608-129061630 TGTTTGGACCAGGTTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169419 Original CRISPR TGTTTGGACCAGGTTCAAGA TGG Intergenic
No off target data available for this crispr