ID: 938169895

View in Genome Browser
Species Human (GRCh38)
Location 2:129066010-129066032
Sequence CTGGAAGTTTGTAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938169895_938169898 8 Left 938169895 2:129066010-129066032 CCTTCTTCACTACAAACTTCCAG No data
Right 938169898 2:129066041-129066063 TACCTGAAAGATATCTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938169895 Original CRISPR CTGGAAGTTTGTAGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr