ID: 938170170

View in Genome Browser
Species Human (GRCh38)
Location 2:129069191-129069213
Sequence CGATTCCCACAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938170161_938170170 12 Left 938170161 2:129069156-129069178 CCACGTCTAAATCACACCAGGCT No data
Right 938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG No data
938170159_938170170 16 Left 938170159 2:129069152-129069174 CCAGCCACGTCTAAATCACACCA No data
Right 938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG No data
938170164_938170170 -4 Left 938170164 2:129069172-129069194 CCAGGCTGGCAGGCTCTTCCGAT No data
Right 938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938170170 Original CRISPR CGATTCCCACAGATGGGGCA GGG Intergenic
No off target data available for this crispr