ID: 938170346

View in Genome Browser
Species Human (GRCh38)
Location 2:129070219-129070241
Sequence CTCTAGCCAAAGATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938170340_938170346 16 Left 938170340 2:129070180-129070202 CCACGGAGTGGGTCTGAGGGGTC No data
Right 938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG No data
938170337_938170346 19 Left 938170337 2:129070177-129070199 CCTCCACGGAGTGGGTCTGAGGG No data
Right 938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG No data
938170342_938170346 -10 Left 938170342 2:129070206-129070228 CCCCTTTTGTCTTCTCTAGCCAA No data
Right 938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938170346 Original CRISPR CTCTAGCCAAAGATGGAGTG AGG Intergenic
No off target data available for this crispr