ID: 938171070

View in Genome Browser
Species Human (GRCh38)
Location 2:129077162-129077184
Sequence CTGAATATACACATACACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938171070_938171072 26 Left 938171070 2:129077162-129077184 CCATTGTGTATGTGTATATTCAG No data
Right 938171072 2:129077211-129077233 AATGAAACACAATTATAAATGGG No data
938171070_938171071 25 Left 938171070 2:129077162-129077184 CCATTGTGTATGTGTATATTCAG No data
Right 938171071 2:129077210-129077232 TAATGAAACACAATTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938171070 Original CRISPR CTGAATATACACATACACAA TGG (reversed) Intergenic
No off target data available for this crispr