ID: 938174102

View in Genome Browser
Species Human (GRCh38)
Location 2:129108282-129108304
Sequence ATTTTATCTTGCTGGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938174102_938174105 -4 Left 938174102 2:129108282-129108304 CCACTGGTCCAGCAAGATAAAAT No data
Right 938174105 2:129108301-129108323 AAATGGCACTTCAAGCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938174102 Original CRISPR ATTTTATCTTGCTGGACCAG TGG (reversed) Intergenic
No off target data available for this crispr