ID: 938174492

View in Genome Browser
Species Human (GRCh38)
Location 2:129112345-129112367
Sequence CAGGGTGGCCTGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938174482_938174492 -4 Left 938174482 2:129112326-129112348 CCTTCCCGTTGCGTCCTCCCAGG No data
Right 938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG No data
938174487_938174492 -9 Left 938174487 2:129112331-129112353 CCGTTGCGTCCTCCCAGGGTGGC No data
Right 938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG No data
938174485_938174492 -8 Left 938174485 2:129112330-129112352 CCCGTTGCGTCCTCCCAGGGTGG No data
Right 938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938174492 Original CRISPR CAGGGTGGCCTGAGGCAAGA TGG Intergenic
No off target data available for this crispr