ID: 938177779

View in Genome Browser
Species Human (GRCh38)
Location 2:129151974-129151996
Sequence AAGCATTAATGGCCTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938177779_938177783 16 Left 938177779 2:129151974-129151996 CCTCTTTAAGGCCATTAATGCTT No data
Right 938177783 2:129152013-129152035 GGCTATTTTCTACATCTTGTAGG 0: 6
1: 120
2: 360
3: 530
4: 603
938177779_938177781 -5 Left 938177779 2:129151974-129151996 CCTCTTTAAGGCCATTAATGCTT No data
Right 938177781 2:129151992-129152014 TGCTTAGATTTGCCATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938177779 Original CRISPR AAGCATTAATGGCCTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr