ID: 938181619

View in Genome Browser
Species Human (GRCh38)
Location 2:129189803-129189825
Sequence ATTCCTGTCTCATCGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938181619_938181623 3 Left 938181619 2:129189803-129189825 CCCAGAGGCGATGAGACAGGAAT No data
Right 938181623 2:129189829-129189851 GAGCACAGACAGCTTTAGGGTGG No data
938181619_938181624 18 Left 938181619 2:129189803-129189825 CCCAGAGGCGATGAGACAGGAAT No data
Right 938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG No data
938181619_938181622 0 Left 938181619 2:129189803-129189825 CCCAGAGGCGATGAGACAGGAAT No data
Right 938181622 2:129189826-129189848 GCTGAGCACAGACAGCTTTAGGG No data
938181619_938181621 -1 Left 938181619 2:129189803-129189825 CCCAGAGGCGATGAGACAGGAAT No data
Right 938181621 2:129189825-129189847 TGCTGAGCACAGACAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938181619 Original CRISPR ATTCCTGTCTCATCGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr