ID: 938181624

View in Genome Browser
Species Human (GRCh38)
Location 2:129189844-129189866
Sequence TAGGGTGGCCTGAGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938181619_938181624 18 Left 938181619 2:129189803-129189825 CCCAGAGGCGATGAGACAGGAAT No data
Right 938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG No data
938181617_938181624 21 Left 938181617 2:129189800-129189822 CCGCCCAGAGGCGATGAGACAGG No data
Right 938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG No data
938181620_938181624 17 Left 938181620 2:129189804-129189826 CCAGAGGCGATGAGACAGGAATG No data
Right 938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938181624 Original CRISPR TAGGGTGGCCTGAGTGTAGC AGG Intergenic
No off target data available for this crispr