ID: 938183446

View in Genome Browser
Species Human (GRCh38)
Location 2:129206321-129206343
Sequence GACACGCTCCACTGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938183446_938183454 19 Left 938183446 2:129206321-129206343 CCACCTCTGCAGTGGAGCGTGTC No data
Right 938183454 2:129206363-129206385 CCACTCCATGTTTTGCCTTCAGG No data
938183446_938183449 -4 Left 938183446 2:129206321-129206343 CCACCTCTGCAGTGGAGCGTGTC No data
Right 938183449 2:129206340-129206362 TGTCCCATGGACTGTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938183446 Original CRISPR GACACGCTCCACTGCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr