ID: 938183665

View in Genome Browser
Species Human (GRCh38)
Location 2:129208020-129208042
Sequence CGGGTAGATTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938183658_938183665 8 Left 938183658 2:129207989-129208011 CCTGTAATCCCAGCACTTTTGGA 0: 2730
1: 297722
2: 266142
3: 149274
4: 137977
Right 938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG No data
938183656_938183665 29 Left 938183656 2:129207968-129207990 CCAAGCGTGGTGGCTCTCATGCC No data
Right 938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG No data
938183660_938183665 0 Left 938183660 2:129207997-129208019 CCCAGCACTTTTGGAGGCTGAGG 0: 998
1: 95813
2: 219242
3: 240492
4: 281435
Right 938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG No data
938183662_938183665 -1 Left 938183662 2:129207998-129208020 CCAGCACTTTTGGAGGCTGAGGC 0: 606
1: 60603
2: 174687
3: 223227
4: 288957
Right 938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938183665 Original CRISPR CGGGTAGATTACCTGAAGTC AGG Intergenic
No off target data available for this crispr