ID: 938184169

View in Genome Browser
Species Human (GRCh38)
Location 2:129213515-129213537
Sequence GACACTGATATGTTCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938184169_938184173 9 Left 938184169 2:129213515-129213537 CCATCCCAGAACATATCAGTGTC No data
Right 938184173 2:129213547-129213569 GCACACACAATTGTCTTGAAGGG No data
938184169_938184174 17 Left 938184169 2:129213515-129213537 CCATCCCAGAACATATCAGTGTC No data
Right 938184174 2:129213555-129213577 AATTGTCTTGAAGGGCCCAGAGG No data
938184169_938184172 8 Left 938184169 2:129213515-129213537 CCATCCCAGAACATATCAGTGTC No data
Right 938184172 2:129213546-129213568 TGCACACACAATTGTCTTGAAGG No data
938184169_938184175 26 Left 938184169 2:129213515-129213537 CCATCCCAGAACATATCAGTGTC No data
Right 938184175 2:129213564-129213586 GAAGGGCCCAGAGGAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938184169 Original CRISPR GACACTGATATGTTCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr