ID: 938186958

View in Genome Browser
Species Human (GRCh38)
Location 2:129240344-129240366
Sequence TCCTTCCCTCACAGAGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938186958_938186963 19 Left 938186958 2:129240344-129240366 CCACACTCTCTGTGAGGGAAGGA No data
Right 938186963 2:129240386-129240408 GTACATTTGGGAGTAGAAGCTGG No data
938186958_938186961 6 Left 938186958 2:129240344-129240366 CCACACTCTCTGTGAGGGAAGGA No data
Right 938186961 2:129240373-129240395 AATTATCTAACTGGTACATTTGG No data
938186958_938186960 -3 Left 938186958 2:129240344-129240366 CCACACTCTCTGTGAGGGAAGGA No data
Right 938186960 2:129240364-129240386 GGAGGAGTGAATTATCTAACTGG No data
938186958_938186962 7 Left 938186958 2:129240344-129240366 CCACACTCTCTGTGAGGGAAGGA No data
Right 938186962 2:129240374-129240396 ATTATCTAACTGGTACATTTGGG No data
938186958_938186964 20 Left 938186958 2:129240344-129240366 CCACACTCTCTGTGAGGGAAGGA No data
Right 938186964 2:129240387-129240409 TACATTTGGGAGTAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938186958 Original CRISPR TCCTTCCCTCACAGAGAGTG TGG (reversed) Intergenic
No off target data available for this crispr