ID: 938191144

View in Genome Browser
Species Human (GRCh38)
Location 2:129281892-129281914
Sequence TGTCTCCTGCAGGATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938191139_938191144 8 Left 938191139 2:129281861-129281883 CCAGGAAAGCAGTGATGACAGCT No data
Right 938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938191144 Original CRISPR TGTCTCCTGCAGGATGTGGA TGG Intergenic
No off target data available for this crispr