ID: 938191144 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:129281892-129281914 |
| Sequence | TGTCTCCTGCAGGATGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938191139_938191144 | 8 | Left | 938191139 | 2:129281861-129281883 | CCAGGAAAGCAGTGATGACAGCT | No data | ||
| Right | 938191144 | 2:129281892-129281914 | TGTCTCCTGCAGGATGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938191144 | Original CRISPR | TGTCTCCTGCAGGATGTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||