ID: 938191513

View in Genome Browser
Species Human (GRCh38)
Location 2:129285951-129285973
Sequence ACTAATATCTAGACTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938191513_938191515 17 Left 938191513 2:129285951-129285973 CCTTACACAGTCTAGATATTAGT No data
Right 938191515 2:129285991-129286013 GTTTGCAAATATTTTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938191513 Original CRISPR ACTAATATCTAGACTGTGTA AGG (reversed) Intergenic
No off target data available for this crispr