ID: 938191947

View in Genome Browser
Species Human (GRCh38)
Location 2:129291426-129291448
Sequence TCGATGGCTCACAGCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938191947_938191953 21 Left 938191947 2:129291426-129291448 CCTTAGGTGCTGTGAGCCATCGA No data
Right 938191953 2:129291470-129291492 AACTGTGGGAGGAAGATTGAAGG No data
938191947_938191951 7 Left 938191947 2:129291426-129291448 CCTTAGGTGCTGTGAGCCATCGA No data
Right 938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG No data
938191947_938191950 6 Left 938191947 2:129291426-129291448 CCTTAGGTGCTGTGAGCCATCGA No data
Right 938191950 2:129291455-129291477 GTAGGCAAGAAGCAGAACTGTGG No data
938191947_938191952 10 Left 938191947 2:129291426-129291448 CCTTAGGTGCTGTGAGCCATCGA No data
Right 938191952 2:129291459-129291481 GCAAGAAGCAGAACTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938191947 Original CRISPR TCGATGGCTCACAGCACCTA AGG (reversed) Intergenic
No off target data available for this crispr