ID: 938191949

View in Genome Browser
Species Human (GRCh38)
Location 2:129291442-129291464
Sequence TCTTGCCTACAAGCTTTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938191949_938191950 -10 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191950 2:129291455-129291477 GTAGGCAAGAAGCAGAACTGTGG No data
938191949_938191956 30 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191956 2:129291495-129291517 GATTAGTGTGGTAGAGACATGGG No data
938191949_938191954 18 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191954 2:129291483-129291505 AGATTGAAGGAAGATTAGTGTGG No data
938191949_938191955 29 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191955 2:129291494-129291516 AGATTAGTGTGGTAGAGACATGG No data
938191949_938191952 -6 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191952 2:129291459-129291481 GCAAGAAGCAGAACTGTGGGAGG No data
938191949_938191951 -9 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG No data
938191949_938191953 5 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191953 2:129291470-129291492 AACTGTGGGAGGAAGATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938191949 Original CRISPR TCTTGCCTACAAGCTTTCGA TGG (reversed) Intergenic
No off target data available for this crispr