ID: 938191951

View in Genome Browser
Species Human (GRCh38)
Location 2:129291456-129291478
Sequence TAGGCAAGAAGCAGAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938191947_938191951 7 Left 938191947 2:129291426-129291448 CCTTAGGTGCTGTGAGCCATCGA No data
Right 938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG No data
938191949_938191951 -9 Left 938191949 2:129291442-129291464 CCATCGAAAGCTTGTAGGCAAGA No data
Right 938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938191951 Original CRISPR TAGGCAAGAAGCAGAACTGT GGG Intergenic
No off target data available for this crispr