ID: 938193057

View in Genome Browser
Species Human (GRCh38)
Location 2:129300353-129300375
Sequence ATGTGATAGGTTGGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938193050_938193057 2 Left 938193050 2:129300328-129300350 CCGCGCCATCCCAATCTTAAAGC No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193047_938193057 5 Left 938193047 2:129300325-129300347 CCCCCGCGCCATCCCAATCTTAA No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193045_938193057 19 Left 938193045 2:129300311-129300333 CCTGATGTCCATGACCCCCGCGC No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193052_938193057 -7 Left 938193052 2:129300337-129300359 CCCAATCTTAAAGCTCATGTGAT No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193044_938193057 24 Left 938193044 2:129300306-129300328 CCTCTCCTGATGTCCATGACCCC No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193049_938193057 3 Left 938193049 2:129300327-129300349 CCCGCGCCATCCCAATCTTAAAG No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193051_938193057 -3 Left 938193051 2:129300333-129300355 CCATCCCAATCTTAAAGCTCATG No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193048_938193057 4 Left 938193048 2:129300326-129300348 CCCCGCGCCATCCCAATCTTAAA No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193053_938193057 -8 Left 938193053 2:129300338-129300360 CCAATCTTAAAGCTCATGTGATA No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data
938193046_938193057 11 Left 938193046 2:129300319-129300341 CCATGACCCCCGCGCCATCCCAA No data
Right 938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938193057 Original CRISPR ATGTGATAGGTTGGGATCCC TGG Intergenic
No off target data available for this crispr