ID: 938195598

View in Genome Browser
Species Human (GRCh38)
Location 2:129324708-129324730
Sequence TCAGGGGCCCAGGACTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938195598_938195605 10 Left 938195598 2:129324708-129324730 CCCAGACAGTCCTGGGCCCCTGA No data
Right 938195605 2:129324741-129324763 AAGCCACCTTCTCATGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938195598 Original CRISPR TCAGGGGCCCAGGACTGTCT GGG (reversed) Intergenic
No off target data available for this crispr