ID: 938196652

View in Genome Browser
Species Human (GRCh38)
Location 2:129334528-129334550
Sequence GGGGTGAAACGGACAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938196652_938196662 24 Left 938196652 2:129334528-129334550 CCCTCCACTGTCCGTTTCACCCC No data
Right 938196662 2:129334575-129334597 TGTTCACATCTATTTTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938196652 Original CRISPR GGGGTGAAACGGACAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr