ID: 938199350

View in Genome Browser
Species Human (GRCh38)
Location 2:129360480-129360502
Sequence CTAGAGAAGCAGTGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938199350_938199355 -10 Left 938199350 2:129360480-129360502 CCCTCCCCACACTGCTTCTCTAG No data
Right 938199355 2:129360493-129360515 GCTTCTCTAGATGTTCTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938199350 Original CRISPR CTAGAGAAGCAGTGTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr