ID: 938201428

View in Genome Browser
Species Human (GRCh38)
Location 2:129376026-129376048
Sequence AAGGCTGAACACAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938201428_938201436 12 Left 938201428 2:129376026-129376048 CCCTCAGCCCTGTGTTCAGCCTT No data
Right 938201436 2:129376061-129376083 GCAAGCAGAGTTCCCTGACCGGG No data
938201428_938201435 11 Left 938201428 2:129376026-129376048 CCCTCAGCCCTGTGTTCAGCCTT No data
Right 938201435 2:129376060-129376082 GGCAAGCAGAGTTCCCTGACCGG No data
938201428_938201439 29 Left 938201428 2:129376026-129376048 CCCTCAGCCCTGTGTTCAGCCTT No data
Right 938201439 2:129376078-129376100 ACCGGGCCCCTGAATTGTCATGG No data
938201428_938201432 -10 Left 938201428 2:129376026-129376048 CCCTCAGCCCTGTGTTCAGCCTT No data
Right 938201432 2:129376039-129376061 GTTCAGCCTTGTCTCCTAGAAGG No data
938201428_938201441 30 Left 938201428 2:129376026-129376048 CCCTCAGCCCTGTGTTCAGCCTT No data
Right 938201441 2:129376079-129376101 CCGGGCCCCTGAATTGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938201428 Original CRISPR AAGGCTGAACACAGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr