ID: 938207091

View in Genome Browser
Species Human (GRCh38)
Location 2:129432990-129433012
Sequence TCTTGTAAGAGGATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938207084_938207091 22 Left 938207084 2:129432945-129432967 CCCTTGGAGAAATAAAGCAATCA No data
Right 938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG No data
938207085_938207091 21 Left 938207085 2:129432946-129432968 CCTTGGAGAAATAAAGCAATCAA No data
Right 938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG No data
938207086_938207091 -4 Left 938207086 2:129432971-129432993 CCTTGCTCATTGTCAAACCTCTT No data
Right 938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938207091 Original CRISPR TCTTGTAAGAGGATGGTGGA TGG Intergenic
No off target data available for this crispr