ID: 938207101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:129433107-129433129 |
| Sequence | ATAGAGTGCGTGGTCATGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938207101_938207104 | 11 | Left | 938207101 | 2:129433107-129433129 | CCACACATGACCACGCACTCTAT | No data | ||
| Right | 938207104 | 2:129433141-129433163 | CATTTATCAATAATAGCTCAAGG | No data | ||||
| 938207101_938207105 | 28 | Left | 938207101 | 2:129433107-129433129 | CCACACATGACCACGCACTCTAT | No data | ||
| Right | 938207105 | 2:129433158-129433180 | TCAAGGACAAAAGAAGCTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938207101 | Original CRISPR | ATAGAGTGCGTGGTCATGTG TGG (reversed) | Intergenic | ||