ID: 938207101

View in Genome Browser
Species Human (GRCh38)
Location 2:129433107-129433129
Sequence ATAGAGTGCGTGGTCATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938207101_938207104 11 Left 938207101 2:129433107-129433129 CCACACATGACCACGCACTCTAT No data
Right 938207104 2:129433141-129433163 CATTTATCAATAATAGCTCAAGG No data
938207101_938207105 28 Left 938207101 2:129433107-129433129 CCACACATGACCACGCACTCTAT No data
Right 938207105 2:129433158-129433180 TCAAGGACAAAAGAAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938207101 Original CRISPR ATAGAGTGCGTGGTCATGTG TGG (reversed) Intergenic