ID: 938207930

View in Genome Browser
Species Human (GRCh38)
Location 2:129439587-129439609
Sequence GCCCATGGCCCACACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938207930_938207938 18 Left 938207930 2:129439587-129439609 CCTCCTCAGTGTGGGCCATGGGC No data
Right 938207938 2:129439628-129439650 GTCAGTTCTGCTTAATTAGGAGG No data
938207930_938207939 19 Left 938207930 2:129439587-129439609 CCTCCTCAGTGTGGGCCATGGGC No data
Right 938207939 2:129439629-129439651 TCAGTTCTGCTTAATTAGGAGGG No data
938207930_938207937 15 Left 938207930 2:129439587-129439609 CCTCCTCAGTGTGGGCCATGGGC No data
Right 938207937 2:129439625-129439647 CATGTCAGTTCTGCTTAATTAGG No data
938207930_938207940 20 Left 938207930 2:129439587-129439609 CCTCCTCAGTGTGGGCCATGGGC No data
Right 938207940 2:129439630-129439652 CAGTTCTGCTTAATTAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938207930 Original CRISPR GCCCATGGCCCACACTGAGG AGG (reversed) Intergenic
No off target data available for this crispr